Review



hnch recombinant human igf 1 preprotech  (Sino Biological)


Bioz Verified Symbol Sino Biological is a verified supplier
Bioz Manufacturer Symbol Sino Biological manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 92
      Buy from Supplier

    Structured Review

    Sino Biological hnch recombinant human igf 1 preprotech
    Hnch Recombinant Human Igf 1 Preprotech, supplied by Sino Biological, used in various techniques. Bioz Stars score: 92/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hnch+recombinant+human+igf+1+preprotech/Human+GDNF+Protein/pmc11384947__mmc12-189-100-110
    Average 92 stars, based on 6 article reviews
    hnch recombinant human igf 1 preprotech - by Bioz Stars, 2026-10
    92/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: A glia-enriched stem cell 3D model of the human brain mimics the glial-immune neurodegenerative phenotypes of multiple sclerosis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GFP Life Technologies Cat# A11122; RRID:AB_221569 Mouse anti-Nestin Millipore Cat# MAB5326 RRID:AB_2251134 Rabbit Anti-Pax6 Biolegend Cat# 901301 RRID:AB_25655003 Mouse anti-Tuj1 Biolegend Cat# 801202 RRID:AB_10063408 Mouse anti-MAP2 Millipore Cat# MAB3418 RRID:AB_11212326 Rabbit anti-GFAP53 Agilent Dako Cat# Z0334 RRID:AB_10013382 Rabbit anti-S100B Agilent Dako Cat# Z0311 RRID:AB_10013383 Rat anti-MBP Millipore Cat# MAB386; RRID:AB_94975 Mouse anti-BCAS1 Santa Cruz Cat# sc-136342 RRID:AB_10839529 Rabbit anti-PDGFRa Cell Signaling Cat# 5241 RRID:AB_10692773 Mouse anti-Human CD45 Agilent Dako Cat# M0701 RRID:AB_2314143 Rat anti-CD11b Biorad Cat# MCA74GA RRID:AB_324660 Rabbit anti-IBA1 Wako Cat# 019–19741 RRID:AB_839504 Rabbit anti-TMEM119 Sigma Cat# HPA051870 RRID:AB_2681645 Alexa Fluor donkey anti-rabbit 488 Thermo Fisher Scientific Cat# A32790 RRID:AB_2762833 Alexa Fluor goat anti-mouse 546 Thermo Fisher Scientific Cat# A21133 RRID:AB_2535772 Alexa Fluor goat anti-rat 663 Thermo Fisher Scientific Cat# A21094 RRID:AB_2535749 Alexa Fluor goat anti-rat 546 Thermo Fisher Scientific Cat# A11081 RRID:AB_2534125 Alexa Fluor goat anti-rabbit 546 Thermo Fisher Scientific Cat# A11010 RRID:AB_2534077 Bacterial and virus strains Chemically competent E. coli (One Shot TOP10) Invitrogen Cat# C404010 Biological samples Fibroblast cultures from cohort This study Table S1 iPSC cultures from cohort This study Table S1 CSF This study Table S6 Chemicals, peptides, and recombinant proteins B-27 supplement lacking vitamin A Gibco Cat# 12587-010 N2 supplement Gibco Cat# 17502-048 Matrigel (Matrigel Growth-factor-reduced) Corning Cat# 354263 hESC-qualified matrix (MaES) BD Biosciences Cat# 354277 ROCK inhibitor (Y-27632) Calbiochem Cat# 688000 Collagenase type IV Gibco Cat# 17104-019 Dorsomorphin StemMACS Cat# 130-104-466 CHIR 99021 trihydrochloride Tocris Cat# 4953 SB-431542 StemMACS Cat# 130-105-336 Purmorphamine ENZO Cat# ALZ-420-045-M001 Neurobasal medium Gibco Cat# 21103-049 DMEM-F12 medium Gibco Cat# 21331-020 mTeSR basal medium STEMCELL Cat# 05851 Penicillin/streptomycin/glutamine Gibco Cat# 15140-122 Ascorbic acid Sigma Aldrich Cat# A4403 Accumax Sigma Aldrich Cat# A7089 Smoothened Agonist (SAG) Millipore Cat# 566660 (Continued on next page) Cell Reports Medicine 5, 101680, August 20, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER BSA Molecular Biology Grade New England Biolabs Cat# B2000S XbaI restriction enzyme New England Biolabs Cat# #R0145 NheI restriction enzyme New England Biolabs Cat# R3131 MluI restriction enzyme New England Biolabs Cat# R3198 SpeI restriction enzyme New England Biolabs Cat# R3133 T4 DNA Polymerase Promega Cat# M4211 Antarctic Phosphatase New England Biolabs Cat# M0289S T4 DNA-ligase New England Biolabs Cat# M0202S SOC medium Invitrogen Cat# 15544034 Ampicillin Roche Cat# 10835269001 Triiodo-L-thyronine (T3) Sigma Aldrich Cat# T6397 Recombinant human PDGF Preprotech Cat# 100-13A Recombinant human NT3 Preprotech Cat# 450-03 Recombinant human GDNF Sino Biological Inc Cat# 10561-HNCH Recombinant human IGF-1 Preprotech Cat# 100-11 Recombinant human BDNF Sino Biological Inc Cat# 50240-MANS dcAMP analog Sigma Aldrich Cat# D0627 Doxycycline hydrochloride Sigma Aldrich Cat# D3447 Triton X-100 reagent Sigma Aldrich Cat# 93420 DAPI fluorescence reagent for DNA Thermo Fisher Scientific Cat# D1306 RapiClearTM 1.47 SUNJin Lab Cat# RC147001 Dako fluorescent mounting medium Agilent Cat# S3023 Epon resin Electron Microscopy Science Cat# 50-980-342 Papain STEMCELL Cat# 074ss66 DNAase I for cell culture STEMCELL Cat# 07900 EcoRI New England Biolabs Cat# R3101 AflIII restriction enzyme New England Biolabs Cat# R0541S NotI restriction enzyme New England Biolabs Cat# R0189S EcoRV restriction enzyme New England Biolabs Cat# R0195S Iscove’s modified Dulbecco medium Sigma Aldrich Cat# I3390 Fetal Bovine Serum Euroclone Cat# ECS0180L Ovomucoid protease inhibitor Worthington Biochemical Cat#LK003182 Critical commercial assays Sendai virus kit Cytotune Invitrogen Cat# A16517 Plasmid DNA Extraction mini kit Cat# DE-034 Xtra Maxi EF Macherey-Nagel Cat# 740424.50 STEMdiffTM Hematopoietic Kit STEMCELL Cat# 05310 STEMdiffTM Micorglia Differentiation Kit STEMCELL Cat# 100-0019 STEMdiffTM Microglia Maturation Kit STEMCELL Cat# 100-0020 RNeasy Mini kit Qiagen Cat# 74106 Thermo Script RT-PCR Invitrogen Cat# 11146-024 SuperScript IV First-Strand Synthesis System Thermo Fisher Scientific Cat# 18091050 Deposited data scRNA-data of this study Deposited to GEO GSE233295 scRNA-seq for human adult cortex Hao et al., 2021.18 GSE164378 scRNA-seq for human fetal brain Cao et al., 2020.19 GSE156793 scRNA-seq for human cortical organoids Birey et al., 2017.20 SRA: SRP096997 scRNA-seq for human cortical organoids Fiddes et al., 2018.21 SRA: SRP121791 (Continued on next page) e2 Cell Reports Medicine 5, 101680, August 20, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER scRNA-seq for human cortical organoids Giandomenico et al., 2019.22 SRA: SRP174405 scRNA-seq for human cortical organoids Madhavan et al., 2018.23 SRA: SRP131980 scRNA-seq for human cortical organoids Quadrato et al., 2017.24 SRA: SRP083140 scRNA-seq for human cortical organoids Trujillo et al., 2019.25 SRA: SRP139859 scRNA-seq for human cortical organoids Velasco et al., 2019.26 SRA: SRP191528 scRNA-seq for human cortical organoids Xiang et al., 2017.27 SRA: SRP105219 scRNA-seq for human multiple sclerosis brain Absinta et al., 2021.3 GSE180759 Experimental models: Cell lines Human Embryonic Kidney (HEK293T) cells ATCC Cat# CRL-1573 RRID:CVCL_0045 Oligonucleotides Probe LV (ATCTCTCTCCTTCTAGCCTC) This paper N/A Primer FW (TACTGACGCTCTCGCACC) This paper N/A Primer REV (TCTCGACGCAGGACTCG) This paper N/A TaqMan Assay for GAPDH, TUBB3, MBP, SOX10, S100B, MAP2, GFAP, OLIG2, CNP, CXCL8, AIF1, NAMPT.

    Fluorescence:

    Article Title: A glia-enriched stem cell 3D model of the human brain mimics the glial-immune neurodegenerative phenotypes of multiple sclerosis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GFP Life Technologies Cat# A11122; RRID:AB_221569 Mouse anti-Nestin Millipore Cat# MAB5326 RRID:AB_2251134 Rabbit Anti-Pax6 Biolegend Cat# 901301 RRID:AB_25655003 Mouse anti-Tuj1 Biolegend Cat# 801202 RRID:AB_10063408 Mouse anti-MAP2 Millipore Cat# MAB3418 RRID:AB_11212326 Rabbit anti-GFAP53 Agilent Dako Cat# Z0334 RRID:AB_10013382 Rabbit anti-S100B Agilent Dako Cat# Z0311 RRID:AB_10013383 Rat anti-MBP Millipore Cat# MAB386; RRID:AB_94975 Mouse anti-BCAS1 Santa Cruz Cat# sc-136342 RRID:AB_10839529 Rabbit anti-PDGFRa Cell Signaling Cat# 5241 RRID:AB_10692773 Mouse anti-Human CD45 Agilent Dako Cat# M0701 RRID:AB_2314143 Rat anti-CD11b Biorad Cat# MCA74GA RRID:AB_324660 Rabbit anti-IBA1 Wako Cat# 019–19741 RRID:AB_839504 Rabbit anti-TMEM119 Sigma Cat# HPA051870 RRID:AB_2681645 Alexa Fluor donkey anti-rabbit 488 Thermo Fisher Scientific Cat# A32790 RRID:AB_2762833 Alexa Fluor goat anti-mouse 546 Thermo Fisher Scientific Cat# A21133 RRID:AB_2535772 Alexa Fluor goat anti-rat 663 Thermo Fisher Scientific Cat# A21094 RRID:AB_2535749 Alexa Fluor goat anti-rat 546 Thermo Fisher Scientific Cat# A11081 RRID:AB_2534125 Alexa Fluor goat anti-rabbit 546 Thermo Fisher Scientific Cat# A11010 RRID:AB_2534077 Bacterial and virus strains Chemically competent E. coli (One Shot TOP10) Invitrogen Cat# C404010 Biological samples Fibroblast cultures from cohort This study Table S1 iPSC cultures from cohort This study Table S1 CSF This study Table S6 Chemicals, peptides, and recombinant proteins B-27 supplement lacking vitamin A Gibco Cat# 12587-010 N2 supplement Gibco Cat# 17502-048 Matrigel (Matrigel Growth-factor-reduced) Corning Cat# 354263 hESC-qualified matrix (MaES) BD Biosciences Cat# 354277 ROCK inhibitor (Y-27632) Calbiochem Cat# 688000 Collagenase type IV Gibco Cat# 17104-019 Dorsomorphin StemMACS Cat# 130-104-466 CHIR 99021 trihydrochloride Tocris Cat# 4953 SB-431542 StemMACS Cat# 130-105-336 Purmorphamine ENZO Cat# ALZ-420-045-M001 Neurobasal medium Gibco Cat# 21103-049 DMEM-F12 medium Gibco Cat# 21331-020 mTeSR basal medium STEMCELL Cat# 05851 Penicillin/streptomycin/glutamine Gibco Cat# 15140-122 Ascorbic acid Sigma Aldrich Cat# A4403 Accumax Sigma Aldrich Cat# A7089 Smoothened Agonist (SAG) Millipore Cat# 566660 (Continued on next page) Cell Reports Medicine 5, 101680, August 20, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER BSA Molecular Biology Grade New England Biolabs Cat# B2000S XbaI restriction enzyme New England Biolabs Cat# #R0145 NheI restriction enzyme New England Biolabs Cat# R3131 MluI restriction enzyme New England Biolabs Cat# R3198 SpeI restriction enzyme New England Biolabs Cat# R3133 T4 DNA Polymerase Promega Cat# M4211 Antarctic Phosphatase New England Biolabs Cat# M0289S T4 DNA-ligase New England Biolabs Cat# M0202S SOC medium Invitrogen Cat# 15544034 Ampicillin Roche Cat# 10835269001 Triiodo-L-thyronine (T3) Sigma Aldrich Cat# T6397 Recombinant human PDGF Preprotech Cat# 100-13A Recombinant human NT3 Preprotech Cat# 450-03 Recombinant human GDNF Sino Biological Inc Cat# 10561-HNCH Recombinant human IGF-1 Preprotech Cat# 100-11 Recombinant human BDNF Sino Biological Inc Cat# 50240-MANS dcAMP analog Sigma Aldrich Cat# D0627 Doxycycline hydrochloride Sigma Aldrich Cat# D3447 Triton X-100 reagent Sigma Aldrich Cat# 93420 DAPI fluorescence reagent for DNA Thermo Fisher Scientific Cat# D1306 RapiClearTM 1.47 SUNJin Lab Cat# RC147001 Dako fluorescent mounting medium Agilent Cat# S3023 Epon resin Electron Microscopy Science Cat# 50-980-342 Papain STEMCELL Cat# 074ss66 DNAase I for cell culture STEMCELL Cat# 07900 EcoRI New England Biolabs Cat# R3101 AflIII restriction enzyme New England Biolabs Cat# R0541S NotI restriction enzyme New England Biolabs Cat# R0189S EcoRV restriction enzyme New England Biolabs Cat# R0195S Iscove’s modified Dulbecco medium Sigma Aldrich Cat# I3390 Fetal Bovine Serum Euroclone Cat# ECS0180L Ovomucoid protease inhibitor Worthington Biochemical Cat#LK003182 Critical commercial assays Sendai virus kit Cytotune Invitrogen Cat# A16517 Plasmid DNA Extraction mini kit Cat# DE-034 Xtra Maxi EF Macherey-Nagel Cat# 740424.50 STEMdiffTM Hematopoietic Kit STEMCELL Cat# 05310 STEMdiffTM Micorglia Differentiation Kit STEMCELL Cat# 100-0019 STEMdiffTM Microglia Maturation Kit STEMCELL Cat# 100-0020 RNeasy Mini kit Qiagen Cat# 74106 Thermo Script RT-PCR Invitrogen Cat# 11146-024 SuperScript IV First-Strand Synthesis System Thermo Fisher Scientific Cat# 18091050 Deposited data scRNA-data of this study Deposited to GEO GSE233295 scRNA-seq for human adult cortex Hao et al., 2021.18 GSE164378 scRNA-seq for human fetal brain Cao et al., 2020.19 GSE156793 scRNA-seq for human cortical organoids Birey et al., 2017.20 SRA: SRP096997 scRNA-seq for human cortical organoids Fiddes et al., 2018.21 SRA: SRP121791 (Continued on next page) e2 Cell Reports Medicine 5, 101680, August 20, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER scRNA-seq for human cortical organoids Giandomenico et al., 2019.22 SRA: SRP174405 scRNA-seq for human cortical organoids Madhavan et al., 2018.23 SRA: SRP131980 scRNA-seq for human cortical organoids Quadrato et al., 2017.24 SRA: SRP083140 scRNA-seq for human cortical organoids Trujillo et al., 2019.25 SRA: SRP139859 scRNA-seq for human cortical organoids Velasco et al., 2019.26 SRA: SRP191528 scRNA-seq for human cortical organoids Xiang et al., 2017.27 SRA: SRP105219 scRNA-seq for human multiple sclerosis brain Absinta et al., 2021.3 GSE180759 Experimental models: Cell lines Human Embryonic Kidney (HEK293T) cells ATCC Cat# CRL-1573 RRID:CVCL_0045 Oligonucleotides Probe LV (ATCTCTCTCCTTCTAGCCTC) This paper N/A Primer FW (TACTGACGCTCTCGCACC) This paper N/A Primer REV (TCTCGACGCAGGACTCG) This paper N/A TaqMan Assay for GAPDH, TUBB3, MBP, SOX10, S100B, MAP2, GFAP, OLIG2, CNP, CXCL8, AIF1, NAMPT.

    Electron Microscopy:

    Article Title: A glia-enriched stem cell 3D model of the human brain mimics the glial-immune neurodegenerative phenotypes of multiple sclerosis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GFP Life Technologies Cat# A11122; RRID:AB_221569 Mouse anti-Nestin Millipore Cat# MAB5326 RRID:AB_2251134 Rabbit Anti-Pax6 Biolegend Cat# 901301 RRID:AB_25655003 Mouse anti-Tuj1 Biolegend Cat# 801202 RRID:AB_10063408 Mouse anti-MAP2 Millipore Cat# MAB3418 RRID:AB_11212326 Rabbit anti-GFAP53 Agilent Dako Cat# Z0334 RRID:AB_10013382 Rabbit anti-S100B Agilent Dako Cat# Z0311 RRID:AB_10013383 Rat anti-MBP Millipore Cat# MAB386; RRID:AB_94975 Mouse anti-BCAS1 Santa Cruz Cat# sc-136342 RRID:AB_10839529 Rabbit anti-PDGFRa Cell Signaling Cat# 5241 RRID:AB_10692773 Mouse anti-Human CD45 Agilent Dako Cat# M0701 RRID:AB_2314143 Rat anti-CD11b Biorad Cat# MCA74GA RRID:AB_324660 Rabbit anti-IBA1 Wako Cat# 019–19741 RRID:AB_839504 Rabbit anti-TMEM119 Sigma Cat# HPA051870 RRID:AB_2681645 Alexa Fluor donkey anti-rabbit 488 Thermo Fisher Scientific Cat# A32790 RRID:AB_2762833 Alexa Fluor goat anti-mouse 546 Thermo Fisher Scientific Cat# A21133 RRID:AB_2535772 Alexa Fluor goat anti-rat 663 Thermo Fisher Scientific Cat# A21094 RRID:AB_2535749 Alexa Fluor goat anti-rat 546 Thermo Fisher Scientific Cat# A11081 RRID:AB_2534125 Alexa Fluor goat anti-rabbit 546 Thermo Fisher Scientific Cat# A11010 RRID:AB_2534077 Bacterial and virus strains Chemically competent E. coli (One Shot TOP10) Invitrogen Cat# C404010 Biological samples Fibroblast cultures from cohort This study Table S1 iPSC cultures from cohort This study Table S1 CSF This study Table S6 Chemicals, peptides, and recombinant proteins B-27 supplement lacking vitamin A Gibco Cat# 12587-010 N2 supplement Gibco Cat# 17502-048 Matrigel (Matrigel Growth-factor-reduced) Corning Cat# 354263 hESC-qualified matrix (MaES) BD Biosciences Cat# 354277 ROCK inhibitor (Y-27632) Calbiochem Cat# 688000 Collagenase type IV Gibco Cat# 17104-019 Dorsomorphin StemMACS Cat# 130-104-466 CHIR 99021 trihydrochloride Tocris Cat# 4953 SB-431542 StemMACS Cat# 130-105-336 Purmorphamine ENZO Cat# ALZ-420-045-M001 Neurobasal medium Gibco Cat# 21103-049 DMEM-F12 medium Gibco Cat# 21331-020 mTeSR basal medium STEMCELL Cat# 05851 Penicillin/streptomycin/glutamine Gibco Cat# 15140-122 Ascorbic acid Sigma Aldrich Cat# A4403 Accumax Sigma Aldrich Cat# A7089 Smoothened Agonist (SAG) Millipore Cat# 566660 (Continued on next page) Cell Reports Medicine 5, 101680, August 20, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER BSA Molecular Biology Grade New England Biolabs Cat# B2000S XbaI restriction enzyme New England Biolabs Cat# #R0145 NheI restriction enzyme New England Biolabs Cat# R3131 MluI restriction enzyme New England Biolabs Cat# R3198 SpeI restriction enzyme New England Biolabs Cat# R3133 T4 DNA Polymerase Promega Cat# M4211 Antarctic Phosphatase New England Biolabs Cat# M0289S T4 DNA-ligase New England Biolabs Cat# M0202S SOC medium Invitrogen Cat# 15544034 Ampicillin Roche Cat# 10835269001 Triiodo-L-thyronine (T3) Sigma Aldrich Cat# T6397 Recombinant human PDGF Preprotech Cat# 100-13A Recombinant human NT3 Preprotech Cat# 450-03 Recombinant human GDNF Sino Biological Inc Cat# 10561-HNCH Recombinant human IGF-1 Preprotech Cat# 100-11 Recombinant human BDNF Sino Biological Inc Cat# 50240-MANS dcAMP analog Sigma Aldrich Cat# D0627 Doxycycline hydrochloride Sigma Aldrich Cat# D3447 Triton X-100 reagent Sigma Aldrich Cat# 93420 DAPI fluorescence reagent for DNA Thermo Fisher Scientific Cat# D1306 RapiClearTM 1.47 SUNJin Lab Cat# RC147001 Dako fluorescent mounting medium Agilent Cat# S3023 Epon resin Electron Microscopy Science Cat# 50-980-342 Papain STEMCELL Cat# 074ss66 DNAase I for cell culture STEMCELL Cat# 07900 EcoRI New England Biolabs Cat# R3101 AflIII restriction enzyme New England Biolabs Cat# R0541S NotI restriction enzyme New England Biolabs Cat# R0189S EcoRV restriction enzyme New England Biolabs Cat# R0195S Iscove’s modified Dulbecco medium Sigma Aldrich Cat# I3390 Fetal Bovine Serum Euroclone Cat# ECS0180L Ovomucoid protease inhibitor Worthington Biochemical Cat#LK003182 Critical commercial assays Sendai virus kit Cytotune Invitrogen Cat# A16517 Plasmid DNA Extraction mini kit Cat# DE-034 Xtra Maxi EF Macherey-Nagel Cat# 740424.50 STEMdiffTM Hematopoietic Kit STEMCELL Cat# 05310 STEMdiffTM Micorglia Differentiation Kit STEMCELL Cat# 100-0019 STEMdiffTM Microglia Maturation Kit STEMCELL Cat# 100-0020 RNeasy Mini kit Qiagen Cat# 74106 Thermo Script RT-PCR Invitrogen Cat# 11146-024 SuperScript IV First-Strand Synthesis System Thermo Fisher Scientific Cat# 18091050 Deposited data scRNA-data of this study Deposited to GEO GSE233295 scRNA-seq for human adult cortex Hao et al., 2021.18 GSE164378 scRNA-seq for human fetal brain Cao et al., 2020.19 GSE156793 scRNA-seq for human cortical organoids Birey et al., 2017.20 SRA: SRP096997 scRNA-seq for human cortical organoids Fiddes et al., 2018.21 SRA: SRP121791 (Continued on next page) e2 Cell Reports Medicine 5, 101680, August 20, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER scRNA-seq for human cortical organoids Giandomenico et al., 2019.22 SRA: SRP174405 scRNA-seq for human cortical organoids Madhavan et al., 2018.23 SRA: SRP131980 scRNA-seq for human cortical organoids Quadrato et al., 2017.24 SRA: SRP083140 scRNA-seq for human cortical organoids Trujillo et al., 2019.25 SRA: SRP139859 scRNA-seq for human cortical organoids Velasco et al., 2019.26 SRA: SRP191528 scRNA-seq for human cortical organoids Xiang et al., 2017.27 SRA: SRP105219 scRNA-seq for human multiple sclerosis brain Absinta et al., 2021.3 GSE180759 Experimental models: Cell lines Human Embryonic Kidney (HEK293T) cells ATCC Cat# CRL-1573 RRID:CVCL_0045 Oligonucleotides Probe LV (ATCTCTCTCCTTCTAGCCTC) This paper N/A Primer FW (TACTGACGCTCTCGCACC) This paper N/A Primer REV (TCTCGACGCAGGACTCG) This paper N/A TaqMan Assay for GAPDH, TUBB3, MBP, SOX10, S100B, MAP2, GFAP, OLIG2, CNP, CXCL8, AIF1, NAMPT.

    Cell Culture:

    Article Title: A glia-enriched stem cell 3D model of the human brain mimics the glial-immune neurodegenerative phenotypes of multiple sclerosis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GFP Life Technologies Cat# A11122; RRID:AB_221569 Mouse anti-Nestin Millipore Cat# MAB5326 RRID:AB_2251134 Rabbit Anti-Pax6 Biolegend Cat# 901301 RRID:AB_25655003 Mouse anti-Tuj1 Biolegend Cat# 801202 RRID:AB_10063408 Mouse anti-MAP2 Millipore Cat# MAB3418 RRID:AB_11212326 Rabbit anti-GFAP53 Agilent Dako Cat# Z0334 RRID:AB_10013382 Rabbit anti-S100B Agilent Dako Cat# Z0311 RRID:AB_10013383 Rat anti-MBP Millipore Cat# MAB386; RRID:AB_94975 Mouse anti-BCAS1 Santa Cruz Cat# sc-136342 RRID:AB_10839529 Rabbit anti-PDGFRa Cell Signaling Cat# 5241 RRID:AB_10692773 Mouse anti-Human CD45 Agilent Dako Cat# M0701 RRID:AB_2314143 Rat anti-CD11b Biorad Cat# MCA74GA RRID:AB_324660 Rabbit anti-IBA1 Wako Cat# 019–19741 RRID:AB_839504 Rabbit anti-TMEM119 Sigma Cat# HPA051870 RRID:AB_2681645 Alexa Fluor donkey anti-rabbit 488 Thermo Fisher Scientific Cat# A32790 RRID:AB_2762833 Alexa Fluor goat anti-mouse 546 Thermo Fisher Scientific Cat# A21133 RRID:AB_2535772 Alexa Fluor goat anti-rat 663 Thermo Fisher Scientific Cat# A21094 RRID:AB_2535749 Alexa Fluor goat anti-rat 546 Thermo Fisher Scientific Cat# A11081 RRID:AB_2534125 Alexa Fluor goat anti-rabbit 546 Thermo Fisher Scientific Cat# A11010 RRID:AB_2534077 Bacterial and virus strains Chemically competent E. coli (One Shot TOP10) Invitrogen Cat# C404010 Biological samples Fibroblast cultures from cohort This study Table S1 iPSC cultures from cohort This study Table S1 CSF This study Table S6 Chemicals, peptides, and recombinant proteins B-27 supplement lacking vitamin A Gibco Cat# 12587-010 N2 supplement Gibco Cat# 17502-048 Matrigel (Matrigel Growth-factor-reduced) Corning Cat# 354263 hESC-qualified matrix (MaES) BD Biosciences Cat# 354277 ROCK inhibitor (Y-27632) Calbiochem Cat# 688000 Collagenase type IV Gibco Cat# 17104-019 Dorsomorphin StemMACS Cat# 130-104-466 CHIR 99021 trihydrochloride Tocris Cat# 4953 SB-431542 StemMACS Cat# 130-105-336 Purmorphamine ENZO Cat# ALZ-420-045-M001 Neurobasal medium Gibco Cat# 21103-049 DMEM-F12 medium Gibco Cat# 21331-020 mTeSR basal medium STEMCELL Cat# 05851 Penicillin/streptomycin/glutamine Gibco Cat# 15140-122 Ascorbic acid Sigma Aldrich Cat# A4403 Accumax Sigma Aldrich Cat# A7089 Smoothened Agonist (SAG) Millipore Cat# 566660 (Continued on next page) Cell Reports Medicine 5, 101680, August 20, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER BSA Molecular Biology Grade New England Biolabs Cat# B2000S XbaI restriction enzyme New England Biolabs Cat# #R0145 NheI restriction enzyme New England Biolabs Cat# R3131 MluI restriction enzyme New England Biolabs Cat# R3198 SpeI restriction enzyme New England Biolabs Cat# R3133 T4 DNA Polymerase Promega Cat# M4211 Antarctic Phosphatase New England Biolabs Cat# M0289S T4 DNA-ligase New England Biolabs Cat# M0202S SOC medium Invitrogen Cat# 15544034 Ampicillin Roche Cat# 10835269001 Triiodo-L-thyronine (T3) Sigma Aldrich Cat# T6397 Recombinant human PDGF Preprotech Cat# 100-13A Recombinant human NT3 Preprotech Cat# 450-03 Recombinant human GDNF Sino Biological Inc Cat# 10561-HNCH Recombinant human IGF-1 Preprotech Cat# 100-11 Recombinant human BDNF Sino Biological Inc Cat# 50240-MANS dcAMP analog Sigma Aldrich Cat# D0627 Doxycycline hydrochloride Sigma Aldrich Cat# D3447 Triton X-100 reagent Sigma Aldrich Cat# 93420 DAPI fluorescence reagent for DNA Thermo Fisher Scientific Cat# D1306 RapiClearTM 1.47 SUNJin Lab Cat# RC147001 Dako fluorescent mounting medium Agilent Cat# S3023 Epon resin Electron Microscopy Science Cat# 50-980-342 Papain STEMCELL Cat# 074ss66 DNAase I for cell culture STEMCELL Cat# 07900 EcoRI New England Biolabs Cat# R3101 AflIII restriction enzyme New England Biolabs Cat# R0541S NotI restriction enzyme New England Biolabs Cat# R0189S EcoRV restriction enzyme New England Biolabs Cat# R0195S Iscove’s modified Dulbecco medium Sigma Aldrich Cat# I3390 Fetal Bovine Serum Euroclone Cat# ECS0180L Ovomucoid protease inhibitor Worthington Biochemical Cat#LK003182 Critical commercial assays Sendai virus kit Cytotune Invitrogen Cat# A16517 Plasmid DNA Extraction mini kit Cat# DE-034 Xtra Maxi EF Macherey-Nagel Cat# 740424.50 STEMdiffTM Hematopoietic Kit STEMCELL Cat# 05310 STEMdiffTM Micorglia Differentiation Kit STEMCELL Cat# 100-0019 STEMdiffTM Microglia Maturation Kit STEMCELL Cat# 100-0020 RNeasy Mini kit Qiagen Cat# 74106 Thermo Script RT-PCR Invitrogen Cat# 11146-024 SuperScript IV First-Strand Synthesis System Thermo Fisher Scientific Cat# 18091050 Deposited data scRNA-data of this study Deposited to GEO GSE233295 scRNA-seq for human adult cortex Hao et al., 2021.18 GSE164378 scRNA-seq for human fetal brain Cao et al., 2020.19 GSE156793 scRNA-seq for human cortical organoids Birey et al., 2017.20 SRA: SRP096997 scRNA-seq for human cortical organoids Fiddes et al., 2018.21 SRA: SRP121791 (Continued on next page) e2 Cell Reports Medicine 5, 101680, August 20, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER scRNA-seq for human cortical organoids Giandomenico et al., 2019.22 SRA: SRP174405 scRNA-seq for human cortical organoids Madhavan et al., 2018.23 SRA: SRP131980 scRNA-seq for human cortical organoids Quadrato et al., 2017.24 SRA: SRP083140 scRNA-seq for human cortical organoids Trujillo et al., 2019.25 SRA: SRP139859 scRNA-seq for human cortical organoids Velasco et al., 2019.26 SRA: SRP191528 scRNA-seq for human cortical organoids Xiang et al., 2017.27 SRA: SRP105219 scRNA-seq for human multiple sclerosis brain Absinta et al., 2021.3 GSE180759 Experimental models: Cell lines Human Embryonic Kidney (HEK293T) cells ATCC Cat# CRL-1573 RRID:CVCL_0045 Oligonucleotides Probe LV (ATCTCTCTCCTTCTAGCCTC) This paper N/A Primer FW (TACTGACGCTCTCGCACC) This paper N/A Primer REV (TCTCGACGCAGGACTCG) This paper N/A TaqMan Assay for GAPDH, TUBB3, MBP, SOX10, S100B, MAP2, GFAP, OLIG2, CNP, CXCL8, AIF1, NAMPT.

    Modification:

    Article Title: A glia-enriched stem cell 3D model of the human brain mimics the glial-immune neurodegenerative phenotypes of multiple sclerosis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GFP Life Technologies Cat# A11122; RRID:AB_221569 Mouse anti-Nestin Millipore Cat# MAB5326 RRID:AB_2251134 Rabbit Anti-Pax6 Biolegend Cat# 901301 RRID:AB_25655003 Mouse anti-Tuj1 Biolegend Cat# 801202 RRID:AB_10063408 Mouse anti-MAP2 Millipore Cat# MAB3418 RRID:AB_11212326 Rabbit anti-GFAP53 Agilent Dako Cat# Z0334 RRID:AB_10013382 Rabbit anti-S100B Agilent Dako Cat# Z0311 RRID:AB_10013383 Rat anti-MBP Millipore Cat# MAB386; RRID:AB_94975 Mouse anti-BCAS1 Santa Cruz Cat# sc-136342 RRID:AB_10839529 Rabbit anti-PDGFRa Cell Signaling Cat# 5241 RRID:AB_10692773 Mouse anti-Human CD45 Agilent Dako Cat# M0701 RRID:AB_2314143 Rat anti-CD11b Biorad Cat# MCA74GA RRID:AB_324660 Rabbit anti-IBA1 Wako Cat# 019–19741 RRID:AB_839504 Rabbit anti-TMEM119 Sigma Cat# HPA051870 RRID:AB_2681645 Alexa Fluor donkey anti-rabbit 488 Thermo Fisher Scientific Cat# A32790 RRID:AB_2762833 Alexa Fluor goat anti-mouse 546 Thermo Fisher Scientific Cat# A21133 RRID:AB_2535772 Alexa Fluor goat anti-rat 663 Thermo Fisher Scientific Cat# A21094 RRID:AB_2535749 Alexa Fluor goat anti-rat 546 Thermo Fisher Scientific Cat# A11081 RRID:AB_2534125 Alexa Fluor goat anti-rabbit 546 Thermo Fisher Scientific Cat# A11010 RRID:AB_2534077 Bacterial and virus strains Chemically competent E. coli (One Shot TOP10) Invitrogen Cat# C404010 Biological samples Fibroblast cultures from cohort This study Table S1 iPSC cultures from cohort This study Table S1 CSF This study Table S6 Chemicals, peptides, and recombinant proteins B-27 supplement lacking vitamin A Gibco Cat# 12587-010 N2 supplement Gibco Cat# 17502-048 Matrigel (Matrigel Growth-factor-reduced) Corning Cat# 354263 hESC-qualified matrix (MaES) BD Biosciences Cat# 354277 ROCK inhibitor (Y-27632) Calbiochem Cat# 688000 Collagenase type IV Gibco Cat# 17104-019 Dorsomorphin StemMACS Cat# 130-104-466 CHIR 99021 trihydrochloride Tocris Cat# 4953 SB-431542 StemMACS Cat# 130-105-336 Purmorphamine ENZO Cat# ALZ-420-045-M001 Neurobasal medium Gibco Cat# 21103-049 DMEM-F12 medium Gibco Cat# 21331-020 mTeSR basal medium STEMCELL Cat# 05851 Penicillin/streptomycin/glutamine Gibco Cat# 15140-122 Ascorbic acid Sigma Aldrich Cat# A4403 Accumax Sigma Aldrich Cat# A7089 Smoothened Agonist (SAG) Millipore Cat# 566660 (Continued on next page) Cell Reports Medicine 5, 101680, August 20, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER BSA Molecular Biology Grade New England Biolabs Cat# B2000S XbaI restriction enzyme New England Biolabs Cat# #R0145 NheI restriction enzyme New England Biolabs Cat# R3131 MluI restriction enzyme New England Biolabs Cat# R3198 SpeI restriction enzyme New England Biolabs Cat# R3133 T4 DNA Polymerase Promega Cat# M4211 Antarctic Phosphatase New England Biolabs Cat# M0289S T4 DNA-ligase New England Biolabs Cat# M0202S SOC medium Invitrogen Cat# 15544034 Ampicillin Roche Cat# 10835269001 Triiodo-L-thyronine (T3) Sigma Aldrich Cat# T6397 Recombinant human PDGF Preprotech Cat# 100-13A Recombinant human NT3 Preprotech Cat# 450-03 Recombinant human GDNF Sino Biological Inc Cat# 10561-HNCH Recombinant human IGF-1 Preprotech Cat# 100-11 Recombinant human BDNF Sino Biological Inc Cat# 50240-MANS dcAMP analog Sigma Aldrich Cat# D0627 Doxycycline hydrochloride Sigma Aldrich Cat# D3447 Triton X-100 reagent Sigma Aldrich Cat# 93420 DAPI fluorescence reagent for DNA Thermo Fisher Scientific Cat# D1306 RapiClearTM 1.47 SUNJin Lab Cat# RC147001 Dako fluorescent mounting medium Agilent Cat# S3023 Epon resin Electron Microscopy Science Cat# 50-980-342 Papain STEMCELL Cat# 074ss66 DNAase I for cell culture STEMCELL Cat# 07900 EcoRI New England Biolabs Cat# R3101 AflIII restriction enzyme New England Biolabs Cat# R0541S NotI restriction enzyme New England Biolabs Cat# R0189S EcoRV restriction enzyme New England Biolabs Cat# R0195S Iscove’s modified Dulbecco medium Sigma Aldrich Cat# I3390 Fetal Bovine Serum Euroclone Cat# ECS0180L Ovomucoid protease inhibitor Worthington Biochemical Cat#LK003182 Critical commercial assays Sendai virus kit Cytotune Invitrogen Cat# A16517 Plasmid DNA Extraction mini kit Cat# DE-034 Xtra Maxi EF Macherey-Nagel Cat# 740424.50 STEMdiffTM Hematopoietic Kit STEMCELL Cat# 05310 STEMdiffTM Micorglia Differentiation Kit STEMCELL Cat# 100-0019 STEMdiffTM Microglia Maturation Kit STEMCELL Cat# 100-0020 RNeasy Mini kit Qiagen Cat# 74106 Thermo Script RT-PCR Invitrogen Cat# 11146-024 SuperScript IV First-Strand Synthesis System Thermo Fisher Scientific Cat# 18091050 Deposited data scRNA-data of this study Deposited to GEO GSE233295 scRNA-seq for human adult cortex Hao et al., 2021.18 GSE164378 scRNA-seq for human fetal brain Cao et al., 2020.19 GSE156793 scRNA-seq for human cortical organoids Birey et al., 2017.20 SRA: SRP096997 scRNA-seq for human cortical organoids Fiddes et al., 2018.21 SRA: SRP121791 (Continued on next page) e2 Cell Reports Medicine 5, 101680, August 20, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER scRNA-seq for human cortical organoids Giandomenico et al., 2019.22 SRA: SRP174405 scRNA-seq for human cortical organoids Madhavan et al., 2018.23 SRA: SRP131980 scRNA-seq for human cortical organoids Quadrato et al., 2017.24 SRA: SRP083140 scRNA-seq for human cortical organoids Trujillo et al., 2019.25 SRA: SRP139859 scRNA-seq for human cortical organoids Velasco et al., 2019.26 SRA: SRP191528 scRNA-seq for human cortical organoids Xiang et al., 2017.27 SRA: SRP105219 scRNA-seq for human multiple sclerosis brain Absinta et al., 2021.3 GSE180759 Experimental models: Cell lines Human Embryonic Kidney (HEK293T) cells ATCC Cat# CRL-1573 RRID:CVCL_0045 Oligonucleotides Probe LV (ATCTCTCTCCTTCTAGCCTC) This paper N/A Primer FW (TACTGACGCTCTCGCACC) This paper N/A Primer REV (TCTCGACGCAGGACTCG) This paper N/A TaqMan Assay for GAPDH, TUBB3, MBP, SOX10, S100B, MAP2, GFAP, OLIG2, CNP, CXCL8, AIF1, NAMPT.

    Protease Inhibitor:

    Article Title: A glia-enriched stem cell 3D model of the human brain mimics the glial-immune neurodegenerative phenotypes of multiple sclerosis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GFP Life Technologies Cat# A11122; RRID:AB_221569 Mouse anti-Nestin Millipore Cat# MAB5326 RRID:AB_2251134 Rabbit Anti-Pax6 Biolegend Cat# 901301 RRID:AB_25655003 Mouse anti-Tuj1 Biolegend Cat# 801202 RRID:AB_10063408 Mouse anti-MAP2 Millipore Cat# MAB3418 RRID:AB_11212326 Rabbit anti-GFAP53 Agilent Dako Cat# Z0334 RRID:AB_10013382 Rabbit anti-S100B Agilent Dako Cat# Z0311 RRID:AB_10013383 Rat anti-MBP Millipore Cat# MAB386; RRID:AB_94975 Mouse anti-BCAS1 Santa Cruz Cat# sc-136342 RRID:AB_10839529 Rabbit anti-PDGFRa Cell Signaling Cat# 5241 RRID:AB_10692773 Mouse anti-Human CD45 Agilent Dako Cat# M0701 RRID:AB_2314143 Rat anti-CD11b Biorad Cat# MCA74GA RRID:AB_324660 Rabbit anti-IBA1 Wako Cat# 019–19741 RRID:AB_839504 Rabbit anti-TMEM119 Sigma Cat# HPA051870 RRID:AB_2681645 Alexa Fluor donkey anti-rabbit 488 Thermo Fisher Scientific Cat# A32790 RRID:AB_2762833 Alexa Fluor goat anti-mouse 546 Thermo Fisher Scientific Cat# A21133 RRID:AB_2535772 Alexa Fluor goat anti-rat 663 Thermo Fisher Scientific Cat# A21094 RRID:AB_2535749 Alexa Fluor goat anti-rat 546 Thermo Fisher Scientific Cat# A11081 RRID:AB_2534125 Alexa Fluor goat anti-rabbit 546 Thermo Fisher Scientific Cat# A11010 RRID:AB_2534077 Bacterial and virus strains Chemically competent E. coli (One Shot TOP10) Invitrogen Cat# C404010 Biological samples Fibroblast cultures from cohort This study Table S1 iPSC cultures from cohort This study Table S1 CSF This study Table S6 Chemicals, peptides, and recombinant proteins B-27 supplement lacking vitamin A Gibco Cat# 12587-010 N2 supplement Gibco Cat# 17502-048 Matrigel (Matrigel Growth-factor-reduced) Corning Cat# 354263 hESC-qualified matrix (MaES) BD Biosciences Cat# 354277 ROCK inhibitor (Y-27632) Calbiochem Cat# 688000 Collagenase type IV Gibco Cat# 17104-019 Dorsomorphin StemMACS Cat# 130-104-466 CHIR 99021 trihydrochloride Tocris Cat# 4953 SB-431542 StemMACS Cat# 130-105-336 Purmorphamine ENZO Cat# ALZ-420-045-M001 Neurobasal medium Gibco Cat# 21103-049 DMEM-F12 medium Gibco Cat# 21331-020 mTeSR basal medium STEMCELL Cat# 05851 Penicillin/streptomycin/glutamine Gibco Cat# 15140-122 Ascorbic acid Sigma Aldrich Cat# A4403 Accumax Sigma Aldrich Cat# A7089 Smoothened Agonist (SAG) Millipore Cat# 566660 (Continued on next page) Cell Reports Medicine 5, 101680, August 20, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER BSA Molecular Biology Grade New England Biolabs Cat# B2000S XbaI restriction enzyme New England Biolabs Cat# #R0145 NheI restriction enzyme New England Biolabs Cat# R3131 MluI restriction enzyme New England Biolabs Cat# R3198 SpeI restriction enzyme New England Biolabs Cat# R3133 T4 DNA Polymerase Promega Cat# M4211 Antarctic Phosphatase New England Biolabs Cat# M0289S T4 DNA-ligase New England Biolabs Cat# M0202S SOC medium Invitrogen Cat# 15544034 Ampicillin Roche Cat# 10835269001 Triiodo-L-thyronine (T3) Sigma Aldrich Cat# T6397 Recombinant human PDGF Preprotech Cat# 100-13A Recombinant human NT3 Preprotech Cat# 450-03 Recombinant human GDNF Sino Biological Inc Cat# 10561-HNCH Recombinant human IGF-1 Preprotech Cat# 100-11 Recombinant human BDNF Sino Biological Inc Cat# 50240-MANS dcAMP analog Sigma Aldrich Cat# D0627 Doxycycline hydrochloride Sigma Aldrich Cat# D3447 Triton X-100 reagent Sigma Aldrich Cat# 93420 DAPI fluorescence reagent for DNA Thermo Fisher Scientific Cat# D1306 RapiClearTM 1.47 SUNJin Lab Cat# RC147001 Dako fluorescent mounting medium Agilent Cat# S3023 Epon resin Electron Microscopy Science Cat# 50-980-342 Papain STEMCELL Cat# 074ss66 DNAase I for cell culture STEMCELL Cat# 07900 EcoRI New England Biolabs Cat# R3101 AflIII restriction enzyme New England Biolabs Cat# R0541S NotI restriction enzyme New England Biolabs Cat# R0189S EcoRV restriction enzyme New England Biolabs Cat# R0195S Iscove’s modified Dulbecco medium Sigma Aldrich Cat# I3390 Fetal Bovine Serum Euroclone Cat# ECS0180L Ovomucoid protease inhibitor Worthington Biochemical Cat#LK003182 Critical commercial assays Sendai virus kit Cytotune Invitrogen Cat# A16517 Plasmid DNA Extraction mini kit Cat# DE-034 Xtra Maxi EF Macherey-Nagel Cat# 740424.50 STEMdiffTM Hematopoietic Kit STEMCELL Cat# 05310 STEMdiffTM Micorglia Differentiation Kit STEMCELL Cat# 100-0019 STEMdiffTM Microglia Maturation Kit STEMCELL Cat# 100-0020 RNeasy Mini kit Qiagen Cat# 74106 Thermo Script RT-PCR Invitrogen Cat# 11146-024 SuperScript IV First-Strand Synthesis System Thermo Fisher Scientific Cat# 18091050 Deposited data scRNA-data of this study Deposited to GEO GSE233295 scRNA-seq for human adult cortex Hao et al., 2021.18 GSE164378 scRNA-seq for human fetal brain Cao et al., 2020.19 GSE156793 scRNA-seq for human cortical organoids Birey et al., 2017.20 SRA: SRP096997 scRNA-seq for human cortical organoids Fiddes et al., 2018.21 SRA: SRP121791 (Continued on next page) e2 Cell Reports Medicine 5, 101680, August 20, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER scRNA-seq for human cortical organoids Giandomenico et al., 2019.22 SRA: SRP174405 scRNA-seq for human cortical organoids Madhavan et al., 2018.23 SRA: SRP131980 scRNA-seq for human cortical organoids Quadrato et al., 2017.24 SRA: SRP083140 scRNA-seq for human cortical organoids Trujillo et al., 2019.25 SRA: SRP139859 scRNA-seq for human cortical organoids Velasco et al., 2019.26 SRA: SRP191528 scRNA-seq for human cortical organoids Xiang et al., 2017.27 SRA: SRP105219 scRNA-seq for human multiple sclerosis brain Absinta et al., 2021.3 GSE180759 Experimental models: Cell lines Human Embryonic Kidney (HEK293T) cells ATCC Cat# CRL-1573 RRID:CVCL_0045 Oligonucleotides Probe LV (ATCTCTCTCCTTCTAGCCTC) This paper N/A Primer FW (TACTGACGCTCTCGCACC) This paper N/A Primer REV (TCTCGACGCAGGACTCG) This paper N/A TaqMan Assay for GAPDH, TUBB3, MBP, SOX10, S100B, MAP2, GFAP, OLIG2, CNP, CXCL8, AIF1, NAMPT.

    Virus:

    Article Title: A glia-enriched stem cell 3D model of the human brain mimics the glial-immune neurodegenerative phenotypes of multiple sclerosis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GFP Life Technologies Cat# A11122; RRID:AB_221569 Mouse anti-Nestin Millipore Cat# MAB5326 RRID:AB_2251134 Rabbit Anti-Pax6 Biolegend Cat# 901301 RRID:AB_25655003 Mouse anti-Tuj1 Biolegend Cat# 801202 RRID:AB_10063408 Mouse anti-MAP2 Millipore Cat# MAB3418 RRID:AB_11212326 Rabbit anti-GFAP53 Agilent Dako Cat# Z0334 RRID:AB_10013382 Rabbit anti-S100B Agilent Dako Cat# Z0311 RRID:AB_10013383 Rat anti-MBP Millipore Cat# MAB386; RRID:AB_94975 Mouse anti-BCAS1 Santa Cruz Cat# sc-136342 RRID:AB_10839529 Rabbit anti-PDGFRa Cell Signaling Cat# 5241 RRID:AB_10692773 Mouse anti-Human CD45 Agilent Dako Cat# M0701 RRID:AB_2314143 Rat anti-CD11b Biorad Cat# MCA74GA RRID:AB_324660 Rabbit anti-IBA1 Wako Cat# 019–19741 RRID:AB_839504 Rabbit anti-TMEM119 Sigma Cat# HPA051870 RRID:AB_2681645 Alexa Fluor donkey anti-rabbit 488 Thermo Fisher Scientific Cat# A32790 RRID:AB_2762833 Alexa Fluor goat anti-mouse 546 Thermo Fisher Scientific Cat# A21133 RRID:AB_2535772 Alexa Fluor goat anti-rat 663 Thermo Fisher Scientific Cat# A21094 RRID:AB_2535749 Alexa Fluor goat anti-rat 546 Thermo Fisher Scientific Cat# A11081 RRID:AB_2534125 Alexa Fluor goat anti-rabbit 546 Thermo Fisher Scientific Cat# A11010 RRID:AB_2534077 Bacterial and virus strains Chemically competent E. coli (One Shot TOP10) Invitrogen Cat# C404010 Biological samples Fibroblast cultures from cohort This study Table S1 iPSC cultures from cohort This study Table S1 CSF This study Table S6 Chemicals, peptides, and recombinant proteins B-27 supplement lacking vitamin A Gibco Cat# 12587-010 N2 supplement Gibco Cat# 17502-048 Matrigel (Matrigel Growth-factor-reduced) Corning Cat# 354263 hESC-qualified matrix (MaES) BD Biosciences Cat# 354277 ROCK inhibitor (Y-27632) Calbiochem Cat# 688000 Collagenase type IV Gibco Cat# 17104-019 Dorsomorphin StemMACS Cat# 130-104-466 CHIR 99021 trihydrochloride Tocris Cat# 4953 SB-431542 StemMACS Cat# 130-105-336 Purmorphamine ENZO Cat# ALZ-420-045-M001 Neurobasal medium Gibco Cat# 21103-049 DMEM-F12 medium Gibco Cat# 21331-020 mTeSR basal medium STEMCELL Cat# 05851 Penicillin/streptomycin/glutamine Gibco Cat# 15140-122 Ascorbic acid Sigma Aldrich Cat# A4403 Accumax Sigma Aldrich Cat# A7089 Smoothened Agonist (SAG) Millipore Cat# 566660 (Continued on next page) Cell Reports Medicine 5, 101680, August 20, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER BSA Molecular Biology Grade New England Biolabs Cat# B2000S XbaI restriction enzyme New England Biolabs Cat# #R0145 NheI restriction enzyme New England Biolabs Cat# R3131 MluI restriction enzyme New England Biolabs Cat# R3198 SpeI restriction enzyme New England Biolabs Cat# R3133 T4 DNA Polymerase Promega Cat# M4211 Antarctic Phosphatase New England Biolabs Cat# M0289S T4 DNA-ligase New England Biolabs Cat# M0202S SOC medium Invitrogen Cat# 15544034 Ampicillin Roche Cat# 10835269001 Triiodo-L-thyronine (T3) Sigma Aldrich Cat# T6397 Recombinant human PDGF Preprotech Cat# 100-13A Recombinant human NT3 Preprotech Cat# 450-03 Recombinant human GDNF Sino Biological Inc Cat# 10561-HNCH Recombinant human IGF-1 Preprotech Cat# 100-11 Recombinant human BDNF Sino Biological Inc Cat# 50240-MANS dcAMP analog Sigma Aldrich Cat# D0627 Doxycycline hydrochloride Sigma Aldrich Cat# D3447 Triton X-100 reagent Sigma Aldrich Cat# 93420 DAPI fluorescence reagent for DNA Thermo Fisher Scientific Cat# D1306 RapiClearTM 1.47 SUNJin Lab Cat# RC147001 Dako fluorescent mounting medium Agilent Cat# S3023 Epon resin Electron Microscopy Science Cat# 50-980-342 Papain STEMCELL Cat# 074ss66 DNAase I for cell culture STEMCELL Cat# 07900 EcoRI New England Biolabs Cat# R3101 AflIII restriction enzyme New England Biolabs Cat# R0541S NotI restriction enzyme New England Biolabs Cat# R0189S EcoRV restriction enzyme New England Biolabs Cat# R0195S Iscove’s modified Dulbecco medium Sigma Aldrich Cat# I3390 Fetal Bovine Serum Euroclone Cat# ECS0180L Ovomucoid protease inhibitor Worthington Biochemical Cat#LK003182 Critical commercial assays Sendai virus kit Cytotune Invitrogen Cat# A16517 Plasmid DNA Extraction mini kit Cat# DE-034 Xtra Maxi EF Macherey-Nagel Cat# 740424.50 STEMdiffTM Hematopoietic Kit STEMCELL Cat# 05310 STEMdiffTM Micorglia Differentiation Kit STEMCELL Cat# 100-0019 STEMdiffTM Microglia Maturation Kit STEMCELL Cat# 100-0020 RNeasy Mini kit Qiagen Cat# 74106 Thermo Script RT-PCR Invitrogen Cat# 11146-024 SuperScript IV First-Strand Synthesis System Thermo Fisher Scientific Cat# 18091050 Deposited data scRNA-data of this study Deposited to GEO GSE233295 scRNA-seq for human adult cortex Hao et al., 2021.18 GSE164378 scRNA-seq for human fetal brain Cao et al., 2020.19 GSE156793 scRNA-seq for human cortical organoids Birey et al., 2017.20 SRA: SRP096997 scRNA-seq for human cortical organoids Fiddes et al., 2018.21 SRA: SRP121791 (Continued on next page) e2 Cell Reports Medicine 5, 101680, August 20, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER scRNA-seq for human cortical organoids Giandomenico et al., 2019.22 SRA: SRP174405 scRNA-seq for human cortical organoids Madhavan et al., 2018.23 SRA: SRP131980 scRNA-seq for human cortical organoids Quadrato et al., 2017.24 SRA: SRP083140 scRNA-seq for human cortical organoids Trujillo et al., 2019.25 SRA: SRP139859 scRNA-seq for human cortical organoids Velasco et al., 2019.26 SRA: SRP191528 scRNA-seq for human cortical organoids Xiang et al., 2017.27 SRA: SRP105219 scRNA-seq for human multiple sclerosis brain Absinta et al., 2021.3 GSE180759 Experimental models: Cell lines Human Embryonic Kidney (HEK293T) cells ATCC Cat# CRL-1573 RRID:CVCL_0045 Oligonucleotides Probe LV (ATCTCTCTCCTTCTAGCCTC) This paper N/A Primer FW (TACTGACGCTCTCGCACC) This paper N/A Primer REV (TCTCGACGCAGGACTCG) This paper N/A TaqMan Assay for GAPDH, TUBB3, MBP, SOX10, S100B, MAP2, GFAP, OLIG2, CNP, CXCL8, AIF1, NAMPT.

    Plasmid Preparation:

    Article Title: A glia-enriched stem cell 3D model of the human brain mimics the glial-immune neurodegenerative phenotypes of multiple sclerosis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GFP Life Technologies Cat# A11122; RRID:AB_221569 Mouse anti-Nestin Millipore Cat# MAB5326 RRID:AB_2251134 Rabbit Anti-Pax6 Biolegend Cat# 901301 RRID:AB_25655003 Mouse anti-Tuj1 Biolegend Cat# 801202 RRID:AB_10063408 Mouse anti-MAP2 Millipore Cat# MAB3418 RRID:AB_11212326 Rabbit anti-GFAP53 Agilent Dako Cat# Z0334 RRID:AB_10013382 Rabbit anti-S100B Agilent Dako Cat# Z0311 RRID:AB_10013383 Rat anti-MBP Millipore Cat# MAB386; RRID:AB_94975 Mouse anti-BCAS1 Santa Cruz Cat# sc-136342 RRID:AB_10839529 Rabbit anti-PDGFRa Cell Signaling Cat# 5241 RRID:AB_10692773 Mouse anti-Human CD45 Agilent Dako Cat# M0701 RRID:AB_2314143 Rat anti-CD11b Biorad Cat# MCA74GA RRID:AB_324660 Rabbit anti-IBA1 Wako Cat# 019–19741 RRID:AB_839504 Rabbit anti-TMEM119 Sigma Cat# HPA051870 RRID:AB_2681645 Alexa Fluor donkey anti-rabbit 488 Thermo Fisher Scientific Cat# A32790 RRID:AB_2762833 Alexa Fluor goat anti-mouse 546 Thermo Fisher Scientific Cat# A21133 RRID:AB_2535772 Alexa Fluor goat anti-rat 663 Thermo Fisher Scientific Cat# A21094 RRID:AB_2535749 Alexa Fluor goat anti-rat 546 Thermo Fisher Scientific Cat# A11081 RRID:AB_2534125 Alexa Fluor goat anti-rabbit 546 Thermo Fisher Scientific Cat# A11010 RRID:AB_2534077 Bacterial and virus strains Chemically competent E. coli (One Shot TOP10) Invitrogen Cat# C404010 Biological samples Fibroblast cultures from cohort This study Table S1 iPSC cultures from cohort This study Table S1 CSF This study Table S6 Chemicals, peptides, and recombinant proteins B-27 supplement lacking vitamin A Gibco Cat# 12587-010 N2 supplement Gibco Cat# 17502-048 Matrigel (Matrigel Growth-factor-reduced) Corning Cat# 354263 hESC-qualified matrix (MaES) BD Biosciences Cat# 354277 ROCK inhibitor (Y-27632) Calbiochem Cat# 688000 Collagenase type IV Gibco Cat# 17104-019 Dorsomorphin StemMACS Cat# 130-104-466 CHIR 99021 trihydrochloride Tocris Cat# 4953 SB-431542 StemMACS Cat# 130-105-336 Purmorphamine ENZO Cat# ALZ-420-045-M001 Neurobasal medium Gibco Cat# 21103-049 DMEM-F12 medium Gibco Cat# 21331-020 mTeSR basal medium STEMCELL Cat# 05851 Penicillin/streptomycin/glutamine Gibco Cat# 15140-122 Ascorbic acid Sigma Aldrich Cat# A4403 Accumax Sigma Aldrich Cat# A7089 Smoothened Agonist (SAG) Millipore Cat# 566660 (Continued on next page) Cell Reports Medicine 5, 101680, August 20, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER BSA Molecular Biology Grade New England Biolabs Cat# B2000S XbaI restriction enzyme New England Biolabs Cat# #R0145 NheI restriction enzyme New England Biolabs Cat# R3131 MluI restriction enzyme New England Biolabs Cat# R3198 SpeI restriction enzyme New England Biolabs Cat# R3133 T4 DNA Polymerase Promega Cat# M4211 Antarctic Phosphatase New England Biolabs Cat# M0289S T4 DNA-ligase New England Biolabs Cat# M0202S SOC medium Invitrogen Cat# 15544034 Ampicillin Roche Cat# 10835269001 Triiodo-L-thyronine (T3) Sigma Aldrich Cat# T6397 Recombinant human PDGF Preprotech Cat# 100-13A Recombinant human NT3 Preprotech Cat# 450-03 Recombinant human GDNF Sino Biological Inc Cat# 10561-HNCH Recombinant human IGF-1 Preprotech Cat# 100-11 Recombinant human BDNF Sino Biological Inc Cat# 50240-MANS dcAMP analog Sigma Aldrich Cat# D0627 Doxycycline hydrochloride Sigma Aldrich Cat# D3447 Triton X-100 reagent Sigma Aldrich Cat# 93420 DAPI fluorescence reagent for DNA Thermo Fisher Scientific Cat# D1306 RapiClearTM 1.47 SUNJin Lab Cat# RC147001 Dako fluorescent mounting medium Agilent Cat# S3023 Epon resin Electron Microscopy Science Cat# 50-980-342 Papain STEMCELL Cat# 074ss66 DNAase I for cell culture STEMCELL Cat# 07900 EcoRI New England Biolabs Cat# R3101 AflIII restriction enzyme New England Biolabs Cat# R0541S NotI restriction enzyme New England Biolabs Cat# R0189S EcoRV restriction enzyme New England Biolabs Cat# R0195S Iscove’s modified Dulbecco medium Sigma Aldrich Cat# I3390 Fetal Bovine Serum Euroclone Cat# ECS0180L Ovomucoid protease inhibitor Worthington Biochemical Cat#LK003182 Critical commercial assays Sendai virus kit Cytotune Invitrogen Cat# A16517 Plasmid DNA Extraction mini kit Cat# DE-034 Xtra Maxi EF Macherey-Nagel Cat# 740424.50 STEMdiffTM Hematopoietic Kit STEMCELL Cat# 05310 STEMdiffTM Micorglia Differentiation Kit STEMCELL Cat# 100-0019 STEMdiffTM Microglia Maturation Kit STEMCELL Cat# 100-0020 RNeasy Mini kit Qiagen Cat# 74106 Thermo Script RT-PCR Invitrogen Cat# 11146-024 SuperScript IV First-Strand Synthesis System Thermo Fisher Scientific Cat# 18091050 Deposited data scRNA-data of this study Deposited to GEO GSE233295 scRNA-seq for human adult cortex Hao et al., 2021.18 GSE164378 scRNA-seq for human fetal brain Cao et al., 2020.19 GSE156793 scRNA-seq for human cortical organoids Birey et al., 2017.20 SRA: SRP096997 scRNA-seq for human cortical organoids Fiddes et al., 2018.21 SRA: SRP121791 (Continued on next page) e2 Cell Reports Medicine 5, 101680, August 20, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER scRNA-seq for human cortical organoids Giandomenico et al., 2019.22 SRA: SRP174405 scRNA-seq for human cortical organoids Madhavan et al., 2018.23 SRA: SRP131980 scRNA-seq for human cortical organoids Quadrato et al., 2017.24 SRA: SRP083140 scRNA-seq for human cortical organoids Trujillo et al., 2019.25 SRA: SRP139859 scRNA-seq for human cortical organoids Velasco et al., 2019.26 SRA: SRP191528 scRNA-seq for human cortical organoids Xiang et al., 2017.27 SRA: SRP105219 scRNA-seq for human multiple sclerosis brain Absinta et al., 2021.3 GSE180759 Experimental models: Cell lines Human Embryonic Kidney (HEK293T) cells ATCC Cat# CRL-1573 RRID:CVCL_0045 Oligonucleotides Probe LV (ATCTCTCTCCTTCTAGCCTC) This paper N/A Primer FW (TACTGACGCTCTCGCACC) This paper N/A Primer REV (TCTCGACGCAGGACTCG) This paper N/A TaqMan Assay for GAPDH, TUBB3, MBP, SOX10, S100B, MAP2, GFAP, OLIG2, CNP, CXCL8, AIF1, NAMPT.

    DNA Extraction:

    Article Title: A glia-enriched stem cell 3D model of the human brain mimics the glial-immune neurodegenerative phenotypes of multiple sclerosis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GFP Life Technologies Cat# A11122; RRID:AB_221569 Mouse anti-Nestin Millipore Cat# MAB5326 RRID:AB_2251134 Rabbit Anti-Pax6 Biolegend Cat# 901301 RRID:AB_25655003 Mouse anti-Tuj1 Biolegend Cat# 801202 RRID:AB_10063408 Mouse anti-MAP2 Millipore Cat# MAB3418 RRID:AB_11212326 Rabbit anti-GFAP53 Agilent Dako Cat# Z0334 RRID:AB_10013382 Rabbit anti-S100B Agilent Dako Cat# Z0311 RRID:AB_10013383 Rat anti-MBP Millipore Cat# MAB386; RRID:AB_94975 Mouse anti-BCAS1 Santa Cruz Cat# sc-136342 RRID:AB_10839529 Rabbit anti-PDGFRa Cell Signaling Cat# 5241 RRID:AB_10692773 Mouse anti-Human CD45 Agilent Dako Cat# M0701 RRID:AB_2314143 Rat anti-CD11b Biorad Cat# MCA74GA RRID:AB_324660 Rabbit anti-IBA1 Wako Cat# 019–19741 RRID:AB_839504 Rabbit anti-TMEM119 Sigma Cat# HPA051870 RRID:AB_2681645 Alexa Fluor donkey anti-rabbit 488 Thermo Fisher Scientific Cat# A32790 RRID:AB_2762833 Alexa Fluor goat anti-mouse 546 Thermo Fisher Scientific Cat# A21133 RRID:AB_2535772 Alexa Fluor goat anti-rat 663 Thermo Fisher Scientific Cat# A21094 RRID:AB_2535749 Alexa Fluor goat anti-rat 546 Thermo Fisher Scientific Cat# A11081 RRID:AB_2534125 Alexa Fluor goat anti-rabbit 546 Thermo Fisher Scientific Cat# A11010 RRID:AB_2534077 Bacterial and virus strains Chemically competent E. coli (One Shot TOP10) Invitrogen Cat# C404010 Biological samples Fibroblast cultures from cohort This study Table S1 iPSC cultures from cohort This study Table S1 CSF This study Table S6 Chemicals, peptides, and recombinant proteins B-27 supplement lacking vitamin A Gibco Cat# 12587-010 N2 supplement Gibco Cat# 17502-048 Matrigel (Matrigel Growth-factor-reduced) Corning Cat# 354263 hESC-qualified matrix (MaES) BD Biosciences Cat# 354277 ROCK inhibitor (Y-27632) Calbiochem Cat# 688000 Collagenase type IV Gibco Cat# 17104-019 Dorsomorphin StemMACS Cat# 130-104-466 CHIR 99021 trihydrochloride Tocris Cat# 4953 SB-431542 StemMACS Cat# 130-105-336 Purmorphamine ENZO Cat# ALZ-420-045-M001 Neurobasal medium Gibco Cat# 21103-049 DMEM-F12 medium Gibco Cat# 21331-020 mTeSR basal medium STEMCELL Cat# 05851 Penicillin/streptomycin/glutamine Gibco Cat# 15140-122 Ascorbic acid Sigma Aldrich Cat# A4403 Accumax Sigma Aldrich Cat# A7089 Smoothened Agonist (SAG) Millipore Cat# 566660 (Continued on next page) Cell Reports Medicine 5, 101680, August 20, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER BSA Molecular Biology Grade New England Biolabs Cat# B2000S XbaI restriction enzyme New England Biolabs Cat# #R0145 NheI restriction enzyme New England Biolabs Cat# R3131 MluI restriction enzyme New England Biolabs Cat# R3198 SpeI restriction enzyme New England Biolabs Cat# R3133 T4 DNA Polymerase Promega Cat# M4211 Antarctic Phosphatase New England Biolabs Cat# M0289S T4 DNA-ligase New England Biolabs Cat# M0202S SOC medium Invitrogen Cat# 15544034 Ampicillin Roche Cat# 10835269001 Triiodo-L-thyronine (T3) Sigma Aldrich Cat# T6397 Recombinant human PDGF Preprotech Cat# 100-13A Recombinant human NT3 Preprotech Cat# 450-03 Recombinant human GDNF Sino Biological Inc Cat# 10561-HNCH Recombinant human IGF-1 Preprotech Cat# 100-11 Recombinant human BDNF Sino Biological Inc Cat# 50240-MANS dcAMP analog Sigma Aldrich Cat# D0627 Doxycycline hydrochloride Sigma Aldrich Cat# D3447 Triton X-100 reagent Sigma Aldrich Cat# 93420 DAPI fluorescence reagent for DNA Thermo Fisher Scientific Cat# D1306 RapiClearTM 1.47 SUNJin Lab Cat# RC147001 Dako fluorescent mounting medium Agilent Cat# S3023 Epon resin Electron Microscopy Science Cat# 50-980-342 Papain STEMCELL Cat# 074ss66 DNAase I for cell culture STEMCELL Cat# 07900 EcoRI New England Biolabs Cat# R3101 AflIII restriction enzyme New England Biolabs Cat# R0541S NotI restriction enzyme New England Biolabs Cat# R0189S EcoRV restriction enzyme New England Biolabs Cat# R0195S Iscove’s modified Dulbecco medium Sigma Aldrich Cat# I3390 Fetal Bovine Serum Euroclone Cat# ECS0180L Ovomucoid protease inhibitor Worthington Biochemical Cat#LK003182 Critical commercial assays Sendai virus kit Cytotune Invitrogen Cat# A16517 Plasmid DNA Extraction mini kit Cat# DE-034 Xtra Maxi EF Macherey-Nagel Cat# 740424.50 STEMdiffTM Hematopoietic Kit STEMCELL Cat# 05310 STEMdiffTM Micorglia Differentiation Kit STEMCELL Cat# 100-0019 STEMdiffTM Microglia Maturation Kit STEMCELL Cat# 100-0020 RNeasy Mini kit Qiagen Cat# 74106 Thermo Script RT-PCR Invitrogen Cat# 11146-024 SuperScript IV First-Strand Synthesis System Thermo Fisher Scientific Cat# 18091050 Deposited data scRNA-data of this study Deposited to GEO GSE233295 scRNA-seq for human adult cortex Hao et al., 2021.18 GSE164378 scRNA-seq for human fetal brain Cao et al., 2020.19 GSE156793 scRNA-seq for human cortical organoids Birey et al., 2017.20 SRA: SRP096997 scRNA-seq for human cortical organoids Fiddes et al., 2018.21 SRA: SRP121791 (Continued on next page) e2 Cell Reports Medicine 5, 101680, August 20, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER scRNA-seq for human cortical organoids Giandomenico et al., 2019.22 SRA: SRP174405 scRNA-seq for human cortical organoids Madhavan et al., 2018.23 SRA: SRP131980 scRNA-seq for human cortical organoids Quadrato et al., 2017.24 SRA: SRP083140 scRNA-seq for human cortical organoids Trujillo et al., 2019.25 SRA: SRP139859 scRNA-seq for human cortical organoids Velasco et al., 2019.26 SRA: SRP191528 scRNA-seq for human cortical organoids Xiang et al., 2017.27 SRA: SRP105219 scRNA-seq for human multiple sclerosis brain Absinta et al., 2021.3 GSE180759 Experimental models: Cell lines Human Embryonic Kidney (HEK293T) cells ATCC Cat# CRL-1573 RRID:CVCL_0045 Oligonucleotides Probe LV (ATCTCTCTCCTTCTAGCCTC) This paper N/A Primer FW (TACTGACGCTCTCGCACC) This paper N/A Primer REV (TCTCGACGCAGGACTCG) This paper N/A TaqMan Assay for GAPDH, TUBB3, MBP, SOX10, S100B, MAP2, GFAP, OLIG2, CNP, CXCL8, AIF1, NAMPT.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: A glia-enriched stem cell 3D model of the human brain mimics the glial-immune neurodegenerative phenotypes of multiple sclerosis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GFP Life Technologies Cat# A11122; RRID:AB_221569 Mouse anti-Nestin Millipore Cat# MAB5326 RRID:AB_2251134 Rabbit Anti-Pax6 Biolegend Cat# 901301 RRID:AB_25655003 Mouse anti-Tuj1 Biolegend Cat# 801202 RRID:AB_10063408 Mouse anti-MAP2 Millipore Cat# MAB3418 RRID:AB_11212326 Rabbit anti-GFAP53 Agilent Dako Cat# Z0334 RRID:AB_10013382 Rabbit anti-S100B Agilent Dako Cat# Z0311 RRID:AB_10013383 Rat anti-MBP Millipore Cat# MAB386; RRID:AB_94975 Mouse anti-BCAS1 Santa Cruz Cat# sc-136342 RRID:AB_10839529 Rabbit anti-PDGFRa Cell Signaling Cat# 5241 RRID:AB_10692773 Mouse anti-Human CD45 Agilent Dako Cat# M0701 RRID:AB_2314143 Rat anti-CD11b Biorad Cat# MCA74GA RRID:AB_324660 Rabbit anti-IBA1 Wako Cat# 019–19741 RRID:AB_839504 Rabbit anti-TMEM119 Sigma Cat# HPA051870 RRID:AB_2681645 Alexa Fluor donkey anti-rabbit 488 Thermo Fisher Scientific Cat# A32790 RRID:AB_2762833 Alexa Fluor goat anti-mouse 546 Thermo Fisher Scientific Cat# A21133 RRID:AB_2535772 Alexa Fluor goat anti-rat 663 Thermo Fisher Scientific Cat# A21094 RRID:AB_2535749 Alexa Fluor goat anti-rat 546 Thermo Fisher Scientific Cat# A11081 RRID:AB_2534125 Alexa Fluor goat anti-rabbit 546 Thermo Fisher Scientific Cat# A11010 RRID:AB_2534077 Bacterial and virus strains Chemically competent E. coli (One Shot TOP10) Invitrogen Cat# C404010 Biological samples Fibroblast cultures from cohort This study Table S1 iPSC cultures from cohort This study Table S1 CSF This study Table S6 Chemicals, peptides, and recombinant proteins B-27 supplement lacking vitamin A Gibco Cat# 12587-010 N2 supplement Gibco Cat# 17502-048 Matrigel (Matrigel Growth-factor-reduced) Corning Cat# 354263 hESC-qualified matrix (MaES) BD Biosciences Cat# 354277 ROCK inhibitor (Y-27632) Calbiochem Cat# 688000 Collagenase type IV Gibco Cat# 17104-019 Dorsomorphin StemMACS Cat# 130-104-466 CHIR 99021 trihydrochloride Tocris Cat# 4953 SB-431542 StemMACS Cat# 130-105-336 Purmorphamine ENZO Cat# ALZ-420-045-M001 Neurobasal medium Gibco Cat# 21103-049 DMEM-F12 medium Gibco Cat# 21331-020 mTeSR basal medium STEMCELL Cat# 05851 Penicillin/streptomycin/glutamine Gibco Cat# 15140-122 Ascorbic acid Sigma Aldrich Cat# A4403 Accumax Sigma Aldrich Cat# A7089 Smoothened Agonist (SAG) Millipore Cat# 566660 (Continued on next page) Cell Reports Medicine 5, 101680, August 20, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER BSA Molecular Biology Grade New England Biolabs Cat# B2000S XbaI restriction enzyme New England Biolabs Cat# #R0145 NheI restriction enzyme New England Biolabs Cat# R3131 MluI restriction enzyme New England Biolabs Cat# R3198 SpeI restriction enzyme New England Biolabs Cat# R3133 T4 DNA Polymerase Promega Cat# M4211 Antarctic Phosphatase New England Biolabs Cat# M0289S T4 DNA-ligase New England Biolabs Cat# M0202S SOC medium Invitrogen Cat# 15544034 Ampicillin Roche Cat# 10835269001 Triiodo-L-thyronine (T3) Sigma Aldrich Cat# T6397 Recombinant human PDGF Preprotech Cat# 100-13A Recombinant human NT3 Preprotech Cat# 450-03 Recombinant human GDNF Sino Biological Inc Cat# 10561-HNCH Recombinant human IGF-1 Preprotech Cat# 100-11 Recombinant human BDNF Sino Biological Inc Cat# 50240-MANS dcAMP analog Sigma Aldrich Cat# D0627 Doxycycline hydrochloride Sigma Aldrich Cat# D3447 Triton X-100 reagent Sigma Aldrich Cat# 93420 DAPI fluorescence reagent for DNA Thermo Fisher Scientific Cat# D1306 RapiClearTM 1.47 SUNJin Lab Cat# RC147001 Dako fluorescent mounting medium Agilent Cat# S3023 Epon resin Electron Microscopy Science Cat# 50-980-342 Papain STEMCELL Cat# 074ss66 DNAase I for cell culture STEMCELL Cat# 07900 EcoRI New England Biolabs Cat# R3101 AflIII restriction enzyme New England Biolabs Cat# R0541S NotI restriction enzyme New England Biolabs Cat# R0189S EcoRV restriction enzyme New England Biolabs Cat# R0195S Iscove’s modified Dulbecco medium Sigma Aldrich Cat# I3390 Fetal Bovine Serum Euroclone Cat# ECS0180L Ovomucoid protease inhibitor Worthington Biochemical Cat#LK003182 Critical commercial assays Sendai virus kit Cytotune Invitrogen Cat# A16517 Plasmid DNA Extraction mini kit Cat# DE-034 Xtra Maxi EF Macherey-Nagel Cat# 740424.50 STEMdiffTM Hematopoietic Kit STEMCELL Cat# 05310 STEMdiffTM Micorglia Differentiation Kit STEMCELL Cat# 100-0019 STEMdiffTM Microglia Maturation Kit STEMCELL Cat# 100-0020 RNeasy Mini kit Qiagen Cat# 74106 Thermo Script RT-PCR Invitrogen Cat# 11146-024 SuperScript IV First-Strand Synthesis System Thermo Fisher Scientific Cat# 18091050 Deposited data scRNA-data of this study Deposited to GEO GSE233295 scRNA-seq for human adult cortex Hao et al., 2021.18 GSE164378 scRNA-seq for human fetal brain Cao et al., 2020.19 GSE156793 scRNA-seq for human cortical organoids Birey et al., 2017.20 SRA: SRP096997 scRNA-seq for human cortical organoids Fiddes et al., 2018.21 SRA: SRP121791 (Continued on next page) e2 Cell Reports Medicine 5, 101680, August 20, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER scRNA-seq for human cortical organoids Giandomenico et al., 2019.22 SRA: SRP174405 scRNA-seq for human cortical organoids Madhavan et al., 2018.23 SRA: SRP131980 scRNA-seq for human cortical organoids Quadrato et al., 2017.24 SRA: SRP083140 scRNA-seq for human cortical organoids Trujillo et al., 2019.25 SRA: SRP139859 scRNA-seq for human cortical organoids Velasco et al., 2019.26 SRA: SRP191528 scRNA-seq for human cortical organoids Xiang et al., 2017.27 SRA: SRP105219 scRNA-seq for human multiple sclerosis brain Absinta et al., 2021.3 GSE180759 Experimental models: Cell lines Human Embryonic Kidney (HEK293T) cells ATCC Cat# CRL-1573 RRID:CVCL_0045 Oligonucleotides Probe LV (ATCTCTCTCCTTCTAGCCTC) This paper N/A Primer FW (TACTGACGCTCTCGCACC) This paper N/A Primer REV (TCTCGACGCAGGACTCG) This paper N/A TaqMan Assay for GAPDH, TUBB3, MBP, SOX10, S100B, MAP2, GFAP, OLIG2, CNP, CXCL8, AIF1, NAMPT.



    Similar Products

    hnch recombinant human igf 1 preprotech  (Sino Biological)
    92
    Sino Biological hnch recombinant human igf 1 preprotech
    Hnch Recombinant Human Igf 1 Preprotech, supplied by Sino Biological, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hnch+recombinant+human+igf+1+preprotech/Human+GDNF+Protein/pmc11384947__mmc12-189-100-110
    Average 92 stars, based on 1 article reviews
    hnch recombinant human igf 1 preprotech - by Bioz Stars, 2026-10
    92/100 stars
    		  Buy from Supplier

    Image Search Results